Epicentre (an Illumina company)
Contact Us: 800-284-8474           Log In
 
Epicentre Forum 6 (2)

|Epidemiological Typing of Viruses Using the BESS-T™ Base Reader Kit:  Identification of Genetic Variation Among St. Louis Encephalitis Virus Isolates Using an ABI Automated DNA Sequencer|

Rémi N. Charrel(1,2) and Laura J. Chandler(1)
1
Center for Tropical Diseases, Department of Pathology, University of Texas Medical Branch, Galveston, Texas
2Laboratoire de Virologie Moléculaire, Tropicale et Transfusionnelle, Faculté de Médecine, Marseille, France

Introduction

Since the earliest days of virology, typing of viruses has been an important tool to characterize viral populations and to study their epidemiology. Typing provides information on the relationship among isolates within the same group, species, or genus. Historically, serological methods have been used to identify antigenic differences among virus populations. Increasingly, nucleotide or deduced amino acid data have largely replaced serology to provide more sophisticated epidemiological information. However, most molecular methods other than DNA sequencing, such as PCR-based techniques, pulsed field gel electrophoresis, and ribotyping, are either not suitable for viruses or provide data that are too weakly discriminative for typing purposes. Although sequencing is still the preferred method, it is an expensive and time consuming technique, especially when processing a large number of samples. Thus, other molecular methods that are easier and less expensive to perform would be useful for typing of virus isolates for epidemiological studies.

St. Louis encephalitis (SLE) is a human disease caused by a mosquito-borne virus, which is a member of the genus Flavivirus within the family Flaviviridae. SLE virus is widely distributed throughout Canada, the United States, Mexico, Central and South America, and the Caribbean, and is an important cause of arboviral encephalitis in the U.S., with cases occuring in both epidemic and endemic forms.1 SLE virus consists of a positive-sense RNA genome of about 11 kb in length containing 5' and 3' non-coding regions flanking a single open reading frame of approximately 10,500 nucleotides.1

Epidemiological and experimental evidence has suggested the existence of SLE strains harboring distinct biological differences correlated to genetic characteristics, and may impact transmission and disease potential including neurovirulence, ability to cause viremia in birds, and mosquito infectivity. Molecular techniques that have been used for identification of genetic variation among SLE virus isolates include oligonucleotide fingerprinting, single-strand conformation polymorphism (SSCP), and nucleotide sequencing methods.2,3

In this report, we demonstrate the use of the BESS-T Base Reader Kit to identify genetic variation and perform phylogenetic analysis of the envelope gene of 22 SLE virus isolates from various geographical locations in the Americas, and compare the results with those obtained by direct PCR sequencing in the envelope gene.4 The BESS-T Kit is a rapid and powerful method for detecting and localizing approximately 95% of all mutations.5 The BESS procedure involves PCR amplification using one labeled primer in the presence of a limiting amount of dUTP. The uracil-containing PCR product is then enzymatically cleaved at the sites of deoxyuridine incorporation, resulting in a set of nested fragments that are separated on a sequencing gel.

Materials and Methods

Each of the 22 virus strains4 was inoculated onto a confluent Vero cell monolayer and incubated for 3-5 days at 37°C until the cytopathogen effect was evident. RNA was extracted with Trizol LS reagent (Gibco-BRL) under manufacturer's recommendations and resuspended in 50 µl of sterile, RNase-free water. Reverse transciption was performed with the reverse primer at 42°C for one hour. Five microliters were used to amplify a 750-bp fragment of the envelope gene with the forward primer F880 (GATTGGATGGATGCTAGGTAG) and the reverse primer B1629 (GGTTCAAGTCGTGAAACCAGTC). The PCR reaction was performed with the following program: denaturation at 92°C for 1 minute, primer annealing at 56°C for 1 minute, and extension at 72°C for 2 minutes for 25 cycles, followed by a 7-minute final extension. PCR products were purified using the Wizard PCR Preps System (Promega).

BESS-T analysis

Two microliters of a 1:50 dilution of the PCR product was used as target DNA for amplification in a 25 µl reaction containing 2.5 µl of 10X PCR buffer, 1.5 mM final concentration MgCl2, 2 µl of BESS-T dNTP Mix (containing 2.5 mM of each dNTP and 200 µM dUTP, Epicentre), 1.25 U Taq DNA polymerase, 3 pmoles of 6-FAM fluorescent-labeled forward primer (Perkin-Elmer), and 3 pmoles of reverse primer. Amplification cycles were identical to those aforementioned. Eight microliters of PCR product containing dUTP were then mixed on ice with 1 µl of BESS-T 10X Excision Enzyme buffer, 0.5 µl of BESS-T Excision Enzyme Mix, and 0.5 µl of sterile water, and incubated at 37°C for 30 minutes. The reaction was stopped by heating at 95°C for 2 minutes.

Gel electrophoresis

Two microliters of the excision reaction were mixed with 2 µl of formamide and 0.5 µl of fluorescent dye-labeled GS500 size marker (Perkin-Elmer), heated at 95°C for 2 minutes, then quickly cooled on ice. Two microliters were loaded on a standard sequencing gel (6 M urea, 4.8% PAGE-PLUS, Amresco) and run for 4 hours on an ABI Prism® 377XL automated sequencer (Perkin-Elmer).

Data collection

The analysis of the resulting BESS profiles was performed with the Genotyper® 2.0 software (Perkin-Elmer). Analysis was performed using only the BESS-T fragments between nucleotides 924 and 1105 (numbered after the strain MSI-7, GenBank accession no. M16614). Results were provided in a spreadsheet format where labeled fragments were ordered by size and converted into a sequence-like format, which was amenable to analysis using phylogenetics software. The sequence-like data was constructed by replacing each detected fragment by a "T." Nucleotides other than "T," potentially "A," "C," or "G," were identified as "V," the code for "non-T" nucleotide according to the nomenclature to identify redundancies (Table 1). The data were analyzed with the MEGA software program6 and the robustness of the resulting branching patterns was tested by bootstrap analysis (a statistical method based on repeated random sampling with replacement from an original data set to provide a collection of new pseudoreplicate samples, from which sampling variance can be estimated) with 500 replications.

Table 1. BESS-T profile analysis. BESS-T analysis of fragments detected with Genotyper 2.0 software (rows A and B) and the binary sequence (row C) used for phylogenetic analysis. A, size of the marker co-migrating with the sample; B, each value corresponds to the size of a BESS-T fragment; C, the binary sequence deduced from the BESS-T fragments, each detected fragment corresponds to a T base; D, DNA sequence of SL-33 isolate; E, nucleotide positions are numbered relative to the MSI strain (GenBank accession no. M16614); - corresponds to the absence of detected fragment; V corresponds to nucleotide A or C or G.

Nucleotide sequence determination of the 22 SLE virus strains

PCR products were sequenced directly using the F880 and B1629 primers on an ABI Prism 377XL automated sequencer with the BigDye Terminator Cycle Sequencing Ready Reaction Kit using AmpliTaq FS (Perkin-Elmer). Nucleotide sequences located between positions 924 to 1604 were used to perform phylogenetic analysis.

Results

The conversion of the primary data (BESS-T scan, Figure 1) into a binary sequence suitable for phylogenetic analysis and virus isolates comparison is presented in Table 1. Phylogenetic trees based on the 182-nucleotide fragment analyzed by the BESS method and from 182- and 681-nucleotide sequence analyses are presented in Figures 2, 3, and 4 respectively.

Figure 1. Representative BESS-T scans of two different isolates. Differences between the two strains are indicated by the shaded peaks.

Figure 2. Typing of SLE isolates into 4 groups (A1, A2, B1, and B2) based on geographic origin using the BESS-T method. Phylogenetic analysis using the BESS technique of SLE virus isolates was based on a 182 nucleotide fragment encompassed between nucleotides 924 and 1105 (numbered after the strain MSI-7, GenBank accession no. M16614) located in the envelope gene. Distances and groupings were determined using the MEGA software program. Bootstrap values are indicated and correspond to 500 replications.

Figure 3. Typing of SLE isolates into 4 groups (A1, A2, B1, and B2) based on geographic origin by DNA sequencing. Phylogenetic analysis of SLE virus isolates was based on a 182 nucleotide DNA sequence encompassed between nucleotides 924 and 1105 (numbered after the strain MSI-7, GenBank accession number M16614) located in the envelope gene. Distances and groupings were determined using the MEGA software program. Bootstrap values are indicated and correspond to 500 replications.

Figure 4. Typing of SLE isolates into 4 groups (A1, A2, B1, and B2) based on geographic origin by DNA sequencing. Phylogenetic analysis of SLE virus isolates based on a 681 nucleotide DNA sequence encompassed between positions 924 to 1604 (numbered after the strain MSI-7, GenBank accession number M16614) located in the envelope gene. Distances and groupings were determined using the MEGA software program. Bootstrap values are indicated and correspond to 500 replications.

Regardless of the method (BESS-T or nucleotide sequence), the 22 isolates formed 4 groups based on geographic origin. Eight Panamanian isolates form a clade designated A1 and five South American isolates form the A2 group. North American isolates were divided into two groups: B1, including four isolates recovered from Missouri, Maryland, and Florida; and B2, containing five isolates from California and Texas. The robustness of these groupings was confirmed by the high bootstrap values, ranging from 69% to 100%, obtained for each of the four groups in Figure 4.

Discussion

Molecular techniques can provide a powerful approach to epidemiological typing because of their ability to detect minor genetic changes. DNA sequencing is currently the "gold standard" in molecular analysis of viruses. However, DNA sequencing of RNA viruses, especially viruses that are difficult to cultivate, remains expensive, time-consuming, and sometimes technically challenging. A highly purified product is required for direct sequencing, and in some cases, sequencing must be preceded by cloning and subcloning procedures.

Viruses, because of their small genome size and in many cases their RNA content, are not easily typed by such methods as pulsed field gel electrophoresis of DNA macrorestriction fragments and many PCR-based techniques. Recently, viruses have been typed by various techniques used as alternatives to DNA sequencing. Most of these involve PCR amplification followed by restriction fragment length polymorphism (RFLP), SSCP,7,8 Cleavase® fragment length polymorphism (CFLP®),9 or heteroduplex migration analysis (HMA).10

In RFLP, the choice of enzymes used for restriction digestion needs to be based on the comparison of a large number of sequences to be reliable, and thus is more frequently applied to highly studied viruses. However, even in this favorable case, only relatively short genomic regions (few to 20-base sequences) are investigated for mutations. Additionally, when isolates are closely related, specific distinguishing restriction patterns can rarely be determined. CFLP has recently been used for hepatitis C virus genotype determination9 and seems to be a promising technique, but as in SSCP and HMA, precise localization of the mutations is not possible. Moreover, the pattern provided presents many bands, and computerized analysis may be required when numerous isolates are investigated. RFLP, SSCP, and HMA allow analysis of longer DNA sequences than BESS, but because quantitative data are not collected, they are not suitable for phylogenetic analysis. Mutation mapping cannot be achieved by HMA and SSCP and both need to be optimized to provide reliable results. CFLP and RFLP provide a more precise localization of the mutations, but neither method indicates the nature or the exact positions of the mutations. Finally, most of these methods cannot be used for phylogenetic analysis because of the paucity of quantitative data they generate. Moreover, in none of these techniques do the resulting patterns consistently correlate with the nucleotide sequences of the isolates under study.

In this study, we evaluated the BESS-T Base Reader Kit as a tool to study the molecular epidemiology of SLE isolates in the Americas.4 We compared the ability of the BESS-T method to that of direct sequencing to identify genetic variation among the isolates and to provide phylogenetic data. The 22 isolates have been correctly assigned according to their geographical origin.

Compared to nucleotide sequence data, results obtained by the BESS-T method demonstrate its capability to discriminate between closely related virus strains and thus its usefulness for epidemiological and phylogenetic studies. Because of its simplicity and low-cost, it is applicable for processing large numbers of samples. The sequence-like format of the BESS-T results allows analyses based on computer programs, such as multiple alignment procedures and phylogenetic inferences, which is mostly unlikely with concurrent techniques aforementioned. Although not yet tested, BESS has potential for genetic comparisons of viral strains involved in clinical outbreaks of viral diseases to help investigate their epidemiology. In conclusion, any viral population that can be PCR amplified is a candidate for study of its phylogenetic relationships and its molecular epidemiology by application of the BESS technology.

References

  1. Monath, T.P. et al. (1996). Flaviviruses In Fields Virology, Lippincott-Raven, Philadelphia, PA.
  2. Chandler, L. J. and Nordoff, N. G. (1999) J. Virol. Methods, 80, 169.
  3. Kramer, L.D. et al. (1997) Am. J. Trop. Med. Hyg. 57, 222.
  4. Charrel, R.N. et al. (1999) J. Clin. Microbiol. 37 (6), 1935.
  5. Hawkins, G. A. et al. (1997) Nat. Biotechnol. 15, 803.
  6. Kumar, S. et al. (1993) MEGA: Molecular Evolutionary Genetics Analysis, version 1.02, University Park, PA.
  7. Fujioka, S. et al. (1995) J. Virol. Methods 51, 253.
  8. Lareu, R.R. et al. (1997) J. Virol. Methods 64, 11.
  9. Marshall, D.J. et al. (1997) J. Clin. Microbiol. 35, 3156.
  10. Delwart, E.L. et al. (1993) Science 262, 1257.

Editor's note

Epicentre's BESS-G™ Base Reader Kit detects G sequence changes. The BESS-T&G™ Base Reader Kit combines both the BESS-T and BESS-G technologies allowing detection of 100% of all mutations.


HOME | PRODUCTS | WHAT'S NEW | TECHNICAL RESOURCES | ORDERING | COMPANY

Epicentre on Facebook  Epicentre on Twitter  Epicentre's Technical Blog   Epicentre® (an Illumina® company)
©2012 Epicentre. All Rights Reserved.