|
Epicentre Forum 2 (4)
Debra S. Moore and Scott F. Michael*, Department of
Biology and *Department of Microbiology, University of Alabama at Birmingham,
Birmingham, AL 35294
Mutagenesis of any region of an amplified DNA sequence
can be accomplished in a single reaction by the combined use of a thermostable
DNA polymerase and thermostable DNA ligase.1 This
technique relies on the absence of strand displacement activity of the
thermostable polymerase which allows annealing of an internal mutagenic
primer to the template strand. Phosphorylation of the 5´-end of the
mutagenic primer allows thermostable ligase-mediated incorporation into
the final full-length amplification product. Two amplified fragments
are generally produced in these reactions: a truncated product extending
from the mutagenic primer to the downstream primer, and a full-length
product extending between each of the outer primers (Figure 1). Since
the mutagenic primer is incorporated directly into the product strand,
which is then used as template for subsequent rounds, the proportion
of full-length product containing the mutation will increase with each
cycle. Theoretically, for 100% efficient incorporation, only nine rounds
of thermocycling are necessary to generate greater than 99% mutant product.
In practice, this method generally yields a mutagenesis efficiency of
50% or greater.
 |
Figure 1. Schematic of mutagenesis/amplification reaction and
products. (Primers are designated by the solid arrows.) An
interior mutagenic primer is incorporated into the final product
by using a thermostable ligase. Two products are amplified: a full-length
product which should contain the mutation of interest, and a smaller
fragment resulting from extension from the mutagenic primer to
the downstream primer. |
This procedure is both fast and cost-effective because
it uses a single mutagenic oligo in a single reaction to generate mutants.
The use of a single amplification reaction reduces the incidence of DNA
polymerase errors. Additionally, the mutant product can be cloned into
any plasmid vector desired, eliminating the need to construct and use
specialized vectors to perform mutagenesis.
Here we demonstrate this procedure by using a mutagenic
primer to efficiently introduce a 100 base-pair deletion into a 725 base-pair
fragment of the yeast gal 1/10 promoter. Ampligase Thermostable
DNA Ligase was used to ligate the phosphorylated, mutagenic primer into
the full-length amplified product. The mutated product was then separated
and visualized on an ethidium bromide-stained gel (Figure 2).
 |
Figure 2. Ethidium bromide-stained 3% Nu-Sieve® agarose
gel of mutagenesis/amplification reaction products. Lane 1,
1 kb marker DNA (only small fragments are resolved). Lane 2, normal
amplification reaction using outer primers to generate 725 base-pair
product. Lane 3, mutagenesis/ amplification reaction. Band A is
the full-length wild-type product, band B is the deletion product
produced by incorporation of the mutagenic primer, and band C is
the truncated product produced by amplification between the mutagenic
primer and the downstream primer. |
Phosphorylation of the mutagenic primer
The mutagenic oligo used in the reactions described here
was purchased chemically phosphorylated at the 5´ position (GIBCO
BRL). Alternately, mutagenic oligos can be enzymatically phosphorylated
using T4 Polynucleotide Kinase. Briefly, a reaction consisting of 5 nmol
of mutagenic primer, 10 units of T4 Polynucleotide Kinase (Epicentre),
10 µl of 10X T4 Kinase Buffer (Epicentre) and 100 nmol of ATP in
a total volume of 100 µl yields sufficient phosphorylated primer
for approximately five mutagenesis reactions.
Amplification/Mutagenesis reaction
The reaction conditions used to generate the mutant products
were as follows:
|
100 pmol |
each outer primer |
|
1 nmol |
phosphorylated mutagenic primer |
|
40 nmol |
each dNTP |
|
10 µl |
10X Taq DNA polymerase buffer |
|
5 mM |
MgCl2 |
|
1 mM |
DTT |
|
1 mM |
NAD (Sigma) |
|
1 µl |
(5 U) Ampligase Thermostable DNA Ligase (Epicentre |
|
1 µl |
Taq DNA polymerase |
|
1 ng |
plasmid DNA template |
|
|
Water to a final volume of 100 µl |
Thirty amplification cycles were performed as follows:
|
94°C, 1 min. |
|
40°C, 1 min. |
|
65°C, 6 min. |
(Thermocycling conditions may vary with different primer
sets.)
The sequences of the three primers used in the reaction
were:
|
upstream: |
gcgGAATTCGAATTTTCAAAAATTCTTACT |
|
downstream: |
GGATCGAAGCTTGCTTGCCA |
|
mutagenic: |
CATCGCTTCGCTGATGGATCCGcgtgggcgcAATTTTTCCTCTTCATAAC |
(Capital letters indicate regions complementary to the
template.)
Addition of NAD to the reaction was necessary because it
is a cofactor for Ampligase DNA Ligase. Alternately, the reaction can
be run using the 10X Ampligase Buffer supplied with the enzyme, which
contains NAD. However, for this particular primer set, the use of Ampligase
Buffer resulted in increased levels of non-specific ligation. Thermocycling
conditions may need to be altered for different primer sets. In general,
longer extension times at lower than typical reaction temperatures are
necessary for efficient ligation and polymerization.
Product isolation and cloning
Purification of small, amplified DNA fragments can be
accomplished by several methods including electro-elution, matrix binding,
or spin-filtration. The purified product of the mutagenesis reaction
can be digested and cloned directly into a plasmid of choice. However,
the full-length mutant product should be separated from the smaller,
partial fragment produced during the reaction and any other non-specific
amplified products. A highly sieving agarose gel such as 3% Nu-Sieve® (FMC)
is required to resolve amplified fragments smaller than 1,000 base pairs.
After ethidium bromide staining of the gel, the correct fragment can
be excised and either used directly in a ligation reaction, or purified
from the agarose before ligation.
Figure 2 shows the results of a mutagenesis/amplification
reaction using Ampligase Thermostable DNA Ligase. The mutagenic primer
used in this reaction produces a 100 base-pair deletion in the final
amplification product allowing resolution of the mutant and wild-type
products by agarose gel electrophoresis. The relative intensities of
bands A and B indicate that approximately half of the full-length amplified
product contains the deletion.
This fast and cost-effective procedure allows efficient
incorporation of mutations into any region of amplified DNA. Only a single
reaction is required and mutation efficiencies of 50% or greater are
typically obtained. Ampligase Thermostable DNA Ligase can be used in
this procedure to ligate the internal mutagenic primers into the amplified
product.
-
S.F. Michael (1994) "Mutagenesis by Incorporation of
a Phosphorylated Oligo During PCR Amplification," BioTechniques 16,
410.
|
