Epicentre (an Illumina company)
Contact Us: 800-284-8474           Log In
 

Epicentre Forum 2 (4)

Debra S. Moore and Scott F. Michael*, Department of Biology and *Department of Microbiology, University of Alabama at Birmingham, Birmingham, AL 35294

Introduction

Mutagenesis of any region of an amplified DNA sequence can be accomplished in a single reaction by the combined use of a thermostable DNA polymerase and thermostable DNA ligase.1 This technique relies on the absence of strand displacement activity of the thermostable polymerase which allows annealing of an internal mutagenic primer to the template strand. Phosphorylation of the 5´-end of the mutagenic primer allows thermostable ligase-mediated incorporation into the final full-length amplification product. Two amplified fragments are generally produced in these reactions: a truncated product extending from the mutagenic primer to the downstream primer, and a full-length product extending between each of the outer primers (Figure 1). Since the mutagenic primer is incorporated directly into the product strand, which is then used as template for subsequent rounds, the proportion of full-length product containing the mutation will increase with each cycle. Theoretically, for 100% efficient incorporation, only nine rounds of thermocycling are necessary to generate greater than 99% mutant product. In practice, this method generally yields a mutagenesis efficiency of 50% or greater.

Figure 1. Schematic of mutagenesis/amplification reaction and products. (Primers are designated by the solid arrows.) An interior mutagenic primer is incorporated into the final product by using a thermostable ligase. Two products are amplified: a full-length product which should contain the mutation of interest, and a smaller fragment resulting from extension from the mutagenic primer to the downstream primer.

This procedure is both fast and cost-effective because it uses a single mutagenic oligo in a single reaction to generate mutants. The use of a single amplification reaction reduces the incidence of DNA polymerase errors. Additionally, the mutant product can be cloned into any plasmid vector desired, eliminating the need to construct and use specialized vectors to perform mutagenesis.

Here we demonstrate this procedure by using a mutagenic primer to efficiently introduce a 100 base-pair deletion into a 725 base-pair fragment of the yeast gal 1/10 promoter. Ampligase Thermostable DNA Ligase was used to ligate the phosphorylated, mutagenic primer into the full-length amplified product. The mutated product was then separated and visualized on an ethidium bromide-stained gel (Figure 2).

Figure 2. Ethidium bromide-stained 3% Nu-Sieve® agarose gel of mutagenesis/amplification reaction products. Lane 1, 1 kb marker DNA (only small fragments are resolved). Lane 2, normal amplification reaction using outer primers to generate 725 base-pair product. Lane 3, mutagenesis/ amplification reaction. Band A is the full-length wild-type product, band B is the deletion product produced by incorporation of the mutagenic primer, and band C is the truncated product produced by amplification between the mutagenic primer and the downstream primer.

Procedure

Phosphorylation of the mutagenic primer

The mutagenic oligo used in the reactions described here was purchased chemically phosphorylated at the 5´ position (GIBCO BRL). Alternately, mutagenic oligos can be enzymatically phosphorylated using T4 Polynucleotide Kinase. Briefly, a reaction consisting of 5 nmol of mutagenic primer, 10 units of T4 Polynucleotide Kinase (Epicentre), 10 µl of 10X T4 Kinase Buffer (Epicentre) and 100 nmol of ATP in a total volume of 100 µl yields sufficient phosphorylated primer for approximately five mutagenesis reactions.

Amplification/Mutagenesis reaction

The reaction conditions used to generate the mutant products were as follows:

100 pmol

each outer primer

1 nmol

phosphorylated mutagenic primer

40 nmol

each dNTP

10 µl

10X Taq DNA polymerase buffer

5 mM

MgCl2

1 mM

DTT

1 mM

NAD (Sigma)

1 µl

(5 U) Ampligase Thermostable DNA Ligase (Epicentre

1 µl

Taq DNA polymerase

1 ng

plasmid DNA template

Water to a final volume of 100 µl

Thirty amplification cycles were performed as follows:

94°C, 1 min.

40°C, 1 min.

65°C, 6 min.

(Thermocycling conditions may vary with different primer sets.)

The sequences of the three primers used in the reaction were:

upstream:

gcgGAATTCGAATTTTCAAAAATTCTTACT

downstream:

GGATCGAAGCTTGCTTGCCA

mutagenic:

CATCGCTTCGCTGATGGATCCGcgtgggcgcAATTTTTCCTCTTCATAAC

(Capital letters indicate regions complementary to the template.)

Addition of NAD to the reaction was necessary because it is a cofactor for Ampligase DNA Ligase. Alternately, the reaction can be run using the 10X Ampligase Buffer supplied with the enzyme, which contains NAD. However, for this particular primer set, the use of Ampligase Buffer resulted in increased levels of non-specific ligation. Thermocycling conditions may need to be altered for different primer sets. In general, longer extension times at lower than typical reaction temperatures are necessary for efficient ligation and polymerization.

Product isolation and cloning

Purification of small, amplified DNA fragments can be accomplished by several methods including electro-elution, matrix binding, or spin-filtration. The purified product of the mutagenesis reaction can be digested and cloned directly into a plasmid of choice. However, the full-length mutant product should be separated from the smaller, partial fragment produced during the reaction and any other non-specific amplified products. A highly sieving agarose gel such as 3% Nu-Sieve® (FMC) is required to resolve amplified fragments smaller than 1,000 base pairs. After ethidium bromide staining of the gel, the correct fragment can be excised and either used directly in a ligation reaction, or purified from the agarose before ligation.

Results

Figure 2 shows the results of a mutagenesis/amplification reaction using Ampligase Thermostable DNA Ligase. The mutagenic primer used in this reaction produces a 100 base-pair deletion in the final amplification product allowing resolution of the mutant and wild-type products by agarose gel electrophoresis. The relative intensities of bands A and B indicate that approximately half of the full-length amplified product contains the deletion.

Summary

This fast and cost-effective procedure allows efficient incorporation of mutations into any region of amplified DNA. Only a single reaction is required and mutation efficiencies of 50% or greater are typically obtained. Ampligase Thermostable DNA Ligase can be used in this procedure to ligate the internal mutagenic primers into the amplified product.

References

  1. S.F. Michael (1994) "Mutagenesis by Incorporation of a Phosphorylated Oligo During PCR Amplification," BioTechniques 16, 410.


HOME | PRODUCTS | WHAT'S NEW | TECHNICAL RESOURCES | ORDERING | COMPANY

Epicentre on Facebook  Epicentre on Twitter  Epicentre's Technical Blog   Epicentre® (an Illumina® company)
©2012 Epicentre. All Rights Reserved.